EL : > mes ] eel i LOT 1) (sored . , (> ' rea get ‘ wa it st . ‘ I as M P Is st I . Ile was 25 vear- ol¢ poems Scort Act A snr 2 «fcr a firat viola ‘ ‘ served on Frank McK : . t It is re-urnable oo M a ro M TIN i member the Gos pel Meeting in the Y. M. C. A. on Sunday atte ’ Ky, ondeucted | R ‘ Sirangers always weicome ].-s ° hy 4 “Te pa way heretofore.” = - Meeris Reve ber the Gos yin the Y. M C. A. parlor Sioday af » at 4 ock, conducted by ai lw Strang always w Les foshna 3 4, “Ye have ne i way ‘ f ' Ss u | Mr. Layton McCabe, of A are , re t*-thatduring the storm ot Tuesday las roof of his barrack wa ‘ t by the wind, carried over t au ar aod te pa sited, without j a ya i - Pa ‘ Fa I silver ri ‘ i le parochi+ ta ¢ i m vy Mre. Ledwell, cf Boston, was fis a y A. K. Campbell wast wky per or he pitcher may be obtained at St. Joseph’s Convent. ccntiadiiiilananis Teacnens’ Ixstirure—The Teacher-’ Inst e meets in Queen Square Schoo) this ev vy, at 7.30, sharp. Rev. Mr. Tinat w real apaper at 8 o'clock on fhe Reeponsibilnes of Parents.” The p und especially parents, are cor- d v : ‘cilities Pol : Cerrar. — This forenoon the summons ayainst |homas A. McLean for gell.ng lx without a license was dis- wiescd, the Magistrace holding that the by-law reepecting milk vendors expressly exe ted persons residing in the city who suld miJk from their dwellings. hei Tue Caarmep Cincir.—The Bangor, Me., Commercial pubhshes a hast of the bor-ves which eatered the charwed circle duing last vear. Among the number we notice Mamie D., bom, by Sime, 2.27}, wich made a record of 2.25}. Kimo, the sire of Mam e, 18 DOW owned by Mr. H. G. Murphy, Queen Street. nda Tue Cuamrroysme Mepats.—The gold medals presented by Messrs, Dawsoa and Bartlett, and won by Gaudet in the one and three mile races last Wednesday night, may be seen in the window of the Centra! Drag Store, Sunnyside. Gaudet and Can- ron vill race for two more gold medais ou January 20h, the tickets for which are on sale at the above-named store. epinanatamntin A Sxco Sem KReatizep—The Summer- DAILY EX AMIN To fit young men from 12 to 18 years PROWSE BROTHERS a YOUHS’ ULSTERS. Children's OVERCOATS — To fit boys trom 4 to 12 years of abe ld. 10 dark Cape Coats, $2.75 for $1.38 t heavy frieze Ulsters $5.59 for $2.95 7 Tweed Cape Koats 359 for 1.75 11 heavy cape coats 658 for 3.25\13 fawn Frieze Coats 3.50 for 2 25 7 Fawn Frieze 6.76 for 3,583.10 fawn Prieze Coate 445 for 2.38 t Fawn Frieze 7.50 for 3.75 ll fawn Frieze Coats 5.00 for 2.59 8 Fawn Frieze 8.50 for 4.25.10 fawn Frieze Coais 5 90. for . 2.75 PROWSE BROTHERS ee SATURDAY, JANUARY 16. ae ALL MUST GO BB Bite Wain wis. « 5 « conces cnveccsic% o's o cetconees esas thshes« + sheet gens 8a 80E Ghee 17 Dime Napr...cccccccccrcopecaterccececcpessesecces co suscasees s.edeeseees 4 85 for 248 27 plain Beaver. ....c0.sseccongs eesserece » 8,25 for 2.62 4 plain Reaver.cccosccsseeRoeces occ eqns cessessocccs-covesseseceserses 6-50 for 326 9 plain Beaver......ccccscsesess ee ssconiondeessscccvessccsescoerssesecseses 7.50 for 3.75 3 plain Beaver... .... .25 for 4.12 PROWSE BROT 13 Biack Worsted Youth's Reefers _—Stock of Overcoats. Stock 0/ Man's Reef ae . > 1 Q! . So M1 for $3.4 3 44 Grey Canadian Frieze, &4 G0 ¢ r 2295 ; €Ze, $4 H0 “or $5 2 ee ed Se ee SS ee SSS ee, MAMMOTH SLAUGHTER SALE OF CLOTHING. 3 Stock of Men's Ulsters a heavy black cloth, 8.50 for 4.75) 30 Grey all woo! Frexe 550 | _— 1d Uleters w rth $% 9% for $! 98 3 heavy black cloth, 9.50 for 4.75/51 winecolor Frieze oa ae . 18 all wo | do 6,75 ter 32.38 ¥ heavy blue cloth, 11.50 for 5.75) 39 Blue nap ee 2.62 28 al! weol do 7.00 for 3.60 "13 heavy blue cloth, 10.59 for §.25 23 Blue Nap . : > for 08 2° all wool do 8.75 for 4.22 4 heavy blue cloth, 1450 for Til 14 pia'n blue : oer Ss i all wool do 975 for 4.83 & bea y ble cloth, 13 50 for 6,75) 18 plain blue i sere 38 6 all wool do 190 for 6 25 | 7 plaia blae y 50 a 4 75 3all wooldo 140) for 7.09 HERS vrrRows= BROSPROWSE REOs ?ROWSE BROS. PERSONAL. Mr. B. D. Sharp, of Summerside, was a! home*from St. John’s, Nfld. Hotel Davies this forenoon. ast evening included: John Ogilvy, Ot tawa; Ernest Sumner, Montreal; E, C Leggie, Torontc; N. Cowan, Montreal. Hon. Wm. Harty was at b # desk in the Parliament building yesterday, busily en- gaged in catching up with the work of his departinent. He attended the meet ng of the Cabinet in the afternoon. The genial Commissioner of Public Works seems much improved, and declares that he feels much better. Heis not so stout as’ he was, bat he has apparently recovered his old-time energy. He expects shortly to be again in complete touch with the affairs of the Ontario Pablic Works Department, aud expects that the session will find him ready to take his place in the House and bear his share of the troubles to which Cabinet Ministers are subjected by the gentlemen of the Opposition. —Mail and Empire. a ~ —Al ¢ SI ——m, SUPREME COURT, Frinay, Jan. 15. The Queen vs William Weathedbie.— Larceny from the premises of John Wheatley. The jury disagreed and were discharged. A. Peters for Crown; J. T. Mellish for prisoner. Jas. H. Watis vs. James Kennefick.— Action on the warranty of a horse, Before Justice Fitzgerald and a jary.. W.S. Stewart, Q. C. for plvintitl; A. Peters for iefendent. _ We are obliged to do it—but the goods must be sold—the people would do well to under- stand that however tempting the prices on Clothing and Boots & Shoes are made in other stores, we willdo better for them. and competiton.how- ever great, cannot prevent us underselling.as the stock must positively be closed out. Rem- ember the place. J. B. Mac- donald’s Old Stand, directly opposite the West end Market ouse,. S — 6i. Skating Ricers and Hockeyists should use Friction Body Wash, put up at Cen- tral Drug Store. 13 —3i side correspondent of tne Guardian writes : A very pleasant social was held at Cole- | man last Wednesday eveniag, at which about one hundred dollars was realized, | whch «um was donated to Rev. J. McDou- | gal, P.P. This contribution was made} by Catholics and Protestants, « fact which soraks volumes for the popularity of Facher McDougall. gubectibiiasibce’ A Qverr Traxsrormation.—A year or two ago a Penns; lvavia man wedded Miss Hanoab Ba ter+by, a 600-pound belle of a dime museam. A year atter the marriage Hannah bega: to grow thin and her hus- band to grow fat. Now the buzbaud (who at the time of the wedding was as thin as a rai!) is exhibiting himself a> a fat man. while Miss Patter-by that was has been obliged to take a reef in all her dresses. - C. B.C.—This forenoon the Rev. Mr. Bryan lectured b. fore the students of the C. B. C. in the class- rooms of that in-titu- tion, his subject being “ The Young Man in Business.’ The lecture was exceed- inu’y interesting, and was greatly appre- ciated by the students as well as by the jovited guests. Fullowing the lecture came addresses by Lieutenant-Governor Howlan and Conen! Kane. Rev. Dr. Mor- rison presided. The rooms were tastefully decorated for the occasion. iain Some Catenpan?—We have received from A. Duchemin & Co, a very attrac tive and useful calendar for 1897. The figures are large and easily distinguishable across a roor, aad incidentails the pur chasing pu! are reminded of the god gouds and low prices which obtain at the P. E. Island Sash and Door Factory. Verv good likenesses ot Mesers. A. C. Duchemin and Ernest Dachemin, a3 we'l asa good view of their factory, oecapy prominent positions. The calendar is the work of Tue Examixer Job Printing De periment. Mr. W. C. Kennedy bas our thanks for the calendar of the London and Lanca shire Insurance Cx mpany for 1897. It ie very useful as well as croamental Mr. Byron N. Barns, the popular repre- sentative of Stroud & Sons, Montreal, has kiadly forwarded us the hand+ome calen dar which his firma has issued for 1897. On the calendar are very good likenesses of the prem‘ersof the provinces. PRETTIEST IIEIISERI asst The BATH SPONGEHS Which are now selling at 20 per cent discount, are positively the best ualues we have offered in Sponges. Be one of the many who are taking ad- vantage of oor bargains. Get one to-night. Johnsen & Johnson, RIPIIITITISSITISI LSS IMIS IIIEE FIT CIVTIDTII TIRES MII III IIS ITT Ins ZIDIITSIIISIISIITITIT ITS ‘ HHPHPTD RR APER RE TPPR OND ITT THOPPNAININD 5 SS 5556455 SS 5554555555548 GIVING and GETTING What you give isn’t nearly so important. as what you get, It is a hundred times cheaper to pay a $100 an acre fora good farm than to pay $10 an cere for swamp land. Justso with Furnt- tu.e; you want to know that the inside is as good, or bet- ter than the outside. The hom :made is safe out or in. MARK WRIGHT & 00, LTD The HOME-MAKERS. eS iitiskuunsiauubs Oe SvrveneroropnnnvervennennnrnepnoppT, gonnennnnnnnnTPP POPSET - ADDING we “ma m= FF very useful in any family. Colored and Plaid Dress Stuffs, Pr with these goods, ake room, have the Tue Wearner. +@¥ local snow flurries. SEVERA L Very Desirable Lines of Goods. —— TO OUR —_-— SHORT END AND REMNANT COUNTER. R BROS WE ARE ADDING to-day to our Short End and Remnant Counter a number of desirable things which will be found Ends of Plain and Fancy Silks, Black, nels and Flannelettes, etc., ete., etc. WE ALSO OFFER A LINE OF semi Ladies’ Warm Wrap Cloaks Fur t.immed, satin lined and wadded, worth $5.00 FOR $1.98 Price nor profit does not enter into our calculations * BEER BROS. \AAAAAAAALAAUAAAAAAALAAASAAAAAAGLLAUQAAAAAAGAUAAAAAAAAUGG SALAAM Light to moderate winds, partly fair, higher temperature, a diddddddidd inted and Co'ored Cottons, Flan We are going to and you can bargains. the Queen Hotel Ist vight on his way J. A. Clarke, St. John, reg stered at the ihe arrivals OURS Is YOURS Three months yet of winter weather. Clearing all winter Goods at Special discount- WEEKS’ FURS -« - To clear for cash, All collars;Mufts, Ruffs, Men’s Fur Caps, Men’s Fur Gloves, Ladies’ Fur Capes, Sleigh Robes. Big discounts on all kinds of Fur Goods. - BANKRUPT FURS. We have still a few bankrupt Fur Goods left, a few Astrachan -Jackets. Men’s Fur Coats, Muffs and Collars, ALAdbAAAAAMbAbAAGDAAAALALAUAALANALLALALGLALAALLALAUSAALGUALLGALALAANLALAAA44 Sleigh Robes, ete, These are being cleared at about 49 pcr cent. below usual prices, and the goods are good value. BANKRUPT BLANKETS 85e Blankets now 68c pair; $2.85 Blankets now $1.98 pair; $3.35 blan- kets now $2.45 pair; $4,890 blankets, now $3.65 pair. Tremendous cut in priees—Mantles and Jackets, Millinery and Dress We want to lower our stock in every department before stock tak- ing, and in addition to the many bar- gains offered in our large bankrupt purchase, we offer special inducements tocash buyers from ogg own splendid stock, Goods. SPECIAL PRICES Geov’s Farnishings-—Men’s Lined. Kid Gloves, Gentlemea’s Underclothing, Gent- lemeu’s Linens, Shirta, Collars and Cuffs, Cardigans and Hosiery, Braces and Neck- 11e8. SPECIAL PRICES. Ladies Furnishings—Corsets and Under clothing, Hosiery and Gloves, Trimmed and Untrimmed Milliaery, ana Trimmings Wool Squares and Shawls, Ladies Waiter proofs. Also the Linen House of P.E.J Beached and Unblexched ‘lable Linens Table Napkins, [risy Linen Towels, Doylies, round, oval and square, Roller ings, and Glass Towelings. The buying public will find our values in every de- partment the very best obtainable. Satisfaction guaranteed and Honest Goods at Honest Prices—the People’s Store- W. A. Weeks & Co, Wholesale and Retuai! motto Ow ree $ Try one doz ’ of our Tarts. We know want more. They are @ light, tasty, and baked é just right; price 10c per @ doz Fresh pies, wine cake, Jubilee Buns, Ger- @ man Buns, Doughnuts;ete, @ to-day D STEWART: Telephone 98 ECLIPSE BAKERY, Bakes Best Bread. =e @es @& e 4 et, 4 ee you will => oa =e {4&4 22 28 © @2% ® 32 @0 9% 8 8 => MARRIED At the parzonage, York, on the L3ch_ of Janus rv, 1897, by the Rev. R. Opie, Mr John G. McCallum to Miss ainie Bryenton, both of Brackley Point Road At the manse, Strathalbyn, on Wedres- day, Janusry 6th, by Rev. M. Campbell. Miss Annie M. Cummings, daughter of Mr. Alex. Cummings, Hopedale to Mr. Arthur R. Campbell, of O’L« ary. DIED. In this city, on the 16th inet., Frances A., second daoghter of Ir. 8. R. Jenkins, aged 7 years. At Roxbury Mase.. of Pneumonia on Monday Jan. 11th 1897, John Gafiney age 49 years late of Charlottetown, leaving a wife and seven childrem to mourn their loss. His funeral took plac® on Wednes- day followiog, and theugh but slight notice was given, a large mumber of Island- era and friends of deceared foilowed his remains to Mt. Benediet Cemetery. May his sou! rest. in peace. [Island papers please copy-]] On the (0th iost., at Nine Mile Creek, At Mill View, om the Sth rmst., after a brief illnese, Miss B izabeth Mutlo, eldest daughter of the late Thoma and Cathy rine Mutlow, ia the T3rd year of her «ze. At the residenee “f Ser brother 91 Che’- sea street, Hast Boeion, ob Jav. 11, Cebas Mciotyre, aged 29 years. ss ———— —| re Ye choristere, lem1 your notes awee, And swell your kists like kiros; But coe vou mak’ nae batter ot For blithe Rebin Burne. ; Concert on the 25th. eod- -_-rr Last week’s total of busin ees failures jo the United States was one of *he largest 00 record, numbering about 500; and the Presidency. This is the season for 2oid*. no remedy as efficient hott at Watson’s D gg Store. LBPTERS 10 THE EDITOR fer a short illness, Duncan Currie, aged | ees AN ENQUIRY. Sir,—In the Weexiy Examtver of the 8th inst., appeared an article on the Mani- toba School Queetion from which one would inter that the Liberal-Conservative party had given up the question of Separ- ate schools fn Manitoba. Tue Examiner is the acknowledged mouthpiece of that party in this province hence the importance of the article in question. Now, Sir, | would respectfully request you to explain the situation of the Federa! Opposition distinctly on this question. We know the situation as far as the govern— nent is concerned. If the Liberal-Con- servative party have backed down and dropped the question of Separate schools in Manitoba say so at once. Then the Roman Catholics at least will understand the situation and all fair-minded men will understand the situation. By giving these few hastily written remarks a place in the columns of your widely circulated and influential journal you will confer a favoron @ numver of your readers. I am, Sir, Respectfully yours, James EK. Laverrrs, Fort Augustus, Jan. 12th, 1897. _—~-_- LETTER FROM HON, D, DAVIES. Sir,—I notice a letter in your issue of yesterday from Dr. Jeukins, re pork pachs ing, etc. I go further than “ the Doctor” and say that no exemption from city taxa- tion should be granted to the Messrs. Rat- tenbury or anybody else. The Messrs. Ratienbury are enterprising merchants in their line of business, and as such deserve the support of farmers, But it is not to te supposed that they do business for the public interest. Exemption from taxes would be introdacing a v-cious pr.n- ciple into our system of taxation. As I have had some experience in pork packing and meat canning, I desire to wake a few remarks for the information of your readers. Sume years ago, | was engaged in the pork packing business in conjunction with my old and esteemed friend, W. C. Harris; of Brighton. He uaderstood the business thoroughly. We packed for the English and Nova Scotia markets, and had plenty of means at com mand. After about six years work, we gave itup. The late Hon. J. C. Pope tried his hand at.it for two or three years and lost money. The price of pork fluc - tuates with supply aud demand. If the supply is in excess of the world’s consump- tion, down goes the price and it has to be held over for another year. Pork over a. year old becomes rancid and has to b> closed out for best price obtainable. Withregarid to canning beef and mutton, it cannot be done at a_ profit. Large lobster packers such as Mersrs. Long- worth. & Co., and myself have all tbe facilities for carrying on such a business, as the same p:ant used for packing Jobsters is avilable for canning meats and we have always a quantity of empty cans left over from the lobster packing business that we would be glad to use in packing meat. We have both tried itin a small way, and have given up the business, The reason is that we cannot compete with the cheap meat of Buenos Ayres, Texas, and the Western States. It costs in these coun- tries from L to]4cent per Ib. The rail- way expenses to a port of shipment are about the same a3 from Charlottetown. With regard to salting beef dowa in varrels, oar surplus beef is not fat enough tosaltdown and cannot compete with Western beef. Our farmers here get very good prices for their cattle and sheep fur the Newfoundland, St. Pierre and Maritime Provinces markets. I would strongly advise farmers to have nothing to do with pork packing speculations, leave that to private enterprise. It is quite a different matter with re- gard tovur dairyingindustry. I give the late Federa! Governmeat all due cred ¢ for fostering and building up this indu: try aud hope the present government will continue it. It will be the making of our Island province. We havea kindly soi]; bat it requires to be fed. The old system of exhausting it by making oats our staple export has beea largely abandoned. The dairying system feeds the eoil withcut exhausting it, and the produ t; of the dairy pay better than growing eu exhaustive crop of oats. Of course every good farmer will grow enough «f oa‘s for bis own requirements and a surplus to sell if he cav spare the Jand. Seme of your young readers will be svr- prised that an old shipbuilder and master mariner should know wuch ebout farm- ing, but I have farmed land and tancy I know something about it. I will be glad to have my remarks criticized by farmers. Your obedient servant, Daniel Davies. Ch’town, Jan. 16, 1897. la THE PORK BUSINESS, Sir,—Dr. Jenkins’ letter sbheull be verv earcfully CJusidered by every farmer on the Island. Why can’t they put up and handle their own pork the same as cheese and butter? They could jastas_ easily prepare theirown pork for the English market as cheese and butter, which has gained a reputation. I.’s a crying shame that farmers, afier feeding bogs, and when marketing them, have to face a combine of a few pork dealers, who set the price inde- pendent of the prices in the Upper Pro- vinces, Which simply means this: “the farmers must sell to us, and we can pay just what we like.” This fall has been the worst for many years taat our farmers have experienced in pork. Let districts commence at once to -tolicit capital to form several factories, get a good superinteneat; thoroughly conversant with theEnglish system ot packing, and when goods ure ready fur shipment go to Halifax, St. John, through Cape Breton, Nora Scotia and New Brunsaick, to solicit orlere,; and wt shipments to English markets no doubt but that good resulis will follow and there will bea handsome profit to the farmers. 13° “ Advance Agent” is within two months 0f The City Council should use good judg- mentin this matter’ and not allow this monopoly of the pork business to continue, by helping with free taxaion to any manufacturer. Liberals are ir power now, and their policy is opposition to protection. : Very few laborers will be added to.‘his new enterprise of pork pagking, as che improved machinery will greatly des en labor. Any manufacturer may ask for the same privilege, and where will the Council draw the line? It also must be remembered that itis difficult to pack pork all throuzh the year, whereas our furniture, woolen, oot and shoe and There ‘8 rs Watson’s Bai- eamic Syrup. It will’ ¢ found to relieves any cough almost ine autiv. 25 cents per machine manufacturers work the entire year. All honor to the Doctor for sound- vog this note of warning and coming out CHURCH SERVICES METHUDIST. Prince Street—Praver meeting at 10.15 Rev. G. M. Campbell at 11 a. m. and 7 p.m. Sundsy School and Bible Class at 2.30. Upper Prince St.—-Prayer meeting at 10 fey. T. F. Fullerton at 11 am. and Rev. D H. Loige at7 p.m. Sundav Schoo! and Bible Class at 3. Epworth League at 3.20. Strangers cordially invited; comfort- able seats provided. PRESBYTERIAN. Zion—Preyer meeting at 10-15 Rev D. Sutherland at ll a.m. and7p. m. Sanday School and Bible Class at 2.30 St. James’—Praver, meeting at 10. Rev. W. J. Kirby atdl and Rev. T.: F. Fullerton at 7. Sunday School and Bible Class at 2.30. ROMAN CATHOLIC. First Mase, 7.30a.m. Children’s Mass. 9a. m. High Mass at 10.30 c’elock. Vespers and Benediction, 7 p. m. CHURCH OF ENGLAND. St.. Paul’s—Morning prayer at il a. m. Holy Communion at 7 p.m.. Sunday School and Bible Class at 2.30. Even ing prayer at 7. All seats free and un- appropriated. Everybody welcome. St. Peter’s.—Moly Communion at &. Matins at 11. a. m. Children’s Catechism and Bible classes, 2.30. Even song at 7 p. m. All seats free and un- appropriated. BAPTIST. Prayer meeting at 10.30. Rev. C. i : W. Corev at lt a. m. and 7p. m. Sunday School and Pastor’s Bible Class at 2.30. Strangers welcome and provided with comfortable seats. CHRISTIAN Church, Upper Great George Street. Rev. Geo. Manifold. at 11 a. m. and 7p.m. Morning topic, “Power from on high.” Evening topie, “Calvary.” Sunday School and Bible Class at 236 p. m (% .P.8.:0. EB. Pri- day evening at 7.30, Prayer meeting Wed nesday evening at 7.30 o’clock. A cordial Invitation to all. SALVATION ARMY. Sunday Services at 7, 1], 3 and 7. Week night services—Monday, Tuesday, Thureday, Friday and Saturday at 8 o’clock. RAILWAY MEN. Gospel Meeting—Remember_ the Gorpel meeting. in Y.M. C. A. Parlor Sunday afternoon at 4 c’clock, conducted by the Railway men. Strangers always welcome. Lesson—Joshus 3-4. ©Ye have not pass- ed this way heretofore.’ Chesinut street, Gaelic servic? at 4 p.m ST. THOMAS CHURCH, LONG CREEK, Morning service and sermon by lay readers every. Sunday at, 11 a. m.—ihe fourth Sunday in each month excepted. Holy Communion on the fourth Sunday in each month—service and sermon by Rev. Mr. Andrews. Mr. Andrews will also con- duct a service and deliver a sermon on thie second Wednesday of each month. URED! CURED AND A PERMANENT CORE ! Cured by Paine’s Celery Compound! Cured by the only medicing that Could Cure! Cured by the Medicine that Can Surely meet your case ! Cured? Yes, perfectly and permanently cured. Paine’s Celery Compound does not, like other medicines, confer only temporary relief. Its work is thorough and far-reaching, and nothing is left, undone. Happy are they indeed who, suffering from disease and sickness make use of Paine’s Celery Compound to re- new their lives. Mrs. John HRelanger,of St. Henri, P.Q., whosé daughter, had bgen brought to realize that she was nearing the’end of her life’s jour- ney, and who was perfegtly cured Uy Paine’s Celery Compound, writes gladly the following letter regarding the permnency of the wonder- ful cure. ; ‘“‘Fightéen ‘ipsths ago Isent youa testi- monial for yopr wonderfull Paine’s Celery Com- pound which had quite restored my daughter to health and strength.after other medicines failed to cure her. “Tam pleased to inform you that the cure has been a permanent one, and thet my daugh- ter owes her present good healh to your great life-giving medicine. I think more of Paine’s Celery Compound to-day than ever before.” —|ou, Have TO Lrust A ClLocK—~ WW. WELLNER GETTING 25 per cent d’s:ount off all and Come for rare bargains. sookeellers. Your jeweler just the, game as you do your doc- tor enl druggi-t. z you are inclined to buy Why not select our jew- clry store when you want | one? There’s a guaran- tee 2and reeord back of every ssle. Qur little jrices, our large s‘cck of cl. cks, our new stylesand our reliability make this the best place to buy, J: WELLER, READY TO TO THE SUNNYSIDE aca s dre eRe s QUEEN SQUARE. MOVE FANCY GOODS Japanese Chinaware, Haszard & Moore, || — SNOW SHOE TREMP Cured Perfectly! Snow Shoes we can supply you at reasonable prices Also Moccasins for Snow Sheeing. Is now in order. If; you have not got a pair of RAVAN VARNA eave made up tier winds Maybe | % fhe Government has Declared ia Faver of Protection % & wilh SUS US US GS OS IS GS US BS GS FS AS iA ’e, i alia ie Phe Fariff Commission Ss Swe to one thine ; empe ne (hingand hat is that whatever chinges may be made j ; : —o POD : woe in the twiff, no change will ba AS 20 ¢ ; » i s+ 2 7 : in the Militia O-der,which says that all ni try "ere . y r ‘niry Overeoits, worn by the Volunteers, Se . ri] > re. - if - - 7 shall be Rizby-Proofed in fature, thus fay ~—T 2 s : ‘ our Volunteers against Rain, Sleet and 2 hncement weather. The Rigby Process can AS be ety | to eny cloth, making it water) roof an s+ aie . . “6 me st ‘| allowing it to remain porous. It will eep vo th x wet, but edmits the air, and canvot be to'd by its appearance from un- proote g. sat tf Py . ol d go.4 ee eee ee ee ee ee tin atl oe = This Cold Weather. A job lot of Boys Lenz Boots at $1.25 to clear, at GORE BROS. Pheonix Fire Office of London ..,...5.......65 cee... Standard Life Assurance Co.......................0.5. British and Foreign Marine Ing. Co............... .. Aseete, $9,000,000 00 NEW INSURANCE NOTICE. ALL BRIT.SH COMPAIIZES Absulute recurity and prompt settlement, North British and Wereantile Fire Ins. Co ...... Assets, $60,000,000.00 Union Assurance Society .................0....c62 serene ee nest $ Aseete, 15,000,000.00 _ Assets, $20,000,000.04 Assets, $69,000,000 06 | Canada Accident Assurance Co, R. K. JOST Headquarters for Snow Shoes. @ Break Up a Cold in Time BY USING PYNY- PECTORAL The Quick Cure for COUGHS, COLDS, CROUP, BRON- CHIiIS, HOARSENESS, ete. | Mrs, Josz>u Norwick, | of G3 Sorauren Ave., Toronto, writes: ! ** Pyny-Pectoral has never failed to cure j my children of croup after a few doses, It cured myself of a long-standing cough after several other remedies had failed. It has also proved an excelient cough cure for my famiy. I prefer it to any other medicine fur coughs, croup or hoarseness,” H. O, Barsovr, **...$ eure for coughs Pyng-Pectoral is the Lest selling medicine I have; my cus- temers will have no other.” Large Bottle, 25 Cts. DAVIS & LAWRENCE CO., Lrn. Proprietors, Montrest <SiE~SHE~O06O Mis Margaret H. Chisholm, STU DILO:—Morris Block. Row, Uutil July Ist; 1897, will give les- sons in Water -Color, and China Painting. Also in Drawing froin Nature. : Special terms and heurs for children attending school. 2—d&kw 4w | | — clear. £0 plain for the farmers. ve AXON. Ladies’ Jackets —— — The balance ot this season's importation at a large discount to T. J HARRIS j i j Queen Street- FRED. W. HWYNDMAN le AGEFT —diaw, sit ly. Prs BEEN BROS | | of Little Rocher, N.B., writes : ‘ j } | } Victoria | Oil, ‘Tapestry, | as any within a radiusofa thousand miles of “us. the cutters and workmen to do it. in winter Overcoats. oes This Strike You? Dozens of Ulsters and Overcoats at INVOICE PRICK. with cost of selling added. As we have more of Sthis lin» of goods than we may be able to sell this season, we make this genuine offer to dis- pose of them. seldom get an apportunity like this to buy at actual cost to We mean to sel! exactly as we advertise. You We don’t consider it necessary to be coatinually harp ng at fhe good quality of work done in ous Taloring Department Se are no amateurs, but are confident that we are in a posi- tion to do as High-class Work i We have Extra good value given D. A Bruce